You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yosR [2019-05-21 17:45:24]
glutaredoxin-like thioredoxin
Genomic Context
categories
[category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other][category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]Gene
Coordinates
2,159,742 2,159,984
The protein
Protein family
Bacterial-type thyA subfamily (according to Swiss-Prot)Structure
[PDB|4BA7] (ancestral thioredoxin relative to Last Bacteria Common Ancestor (LBCA) from the precambrian period) (36% identity), [Pubmed|23932589][SW|Localization]
cell membrane (according to Swiss-Prot)Biological materials
Mutant
BKE20030 ([gene|4A8B6D88FEA9D18E1BAE08847A5F7683F9D6CDF4|yosR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTGCTCTAATTTAATTA, downstream forward: _UP4_TAAAAGGGTAATTTTAAACABKK20030 ([gene|4A8B6D88FEA9D18E1BAE08847A5F7683F9D6CDF4|yosR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTGCTCTAATTTAATTA, downstream forward: _UP4_TAAAAGGGTAATTTTAAACAReferences